arianawallace65 arianawallace65

20-01-2022
Biology

contestada

Evolutionary relationship between modern frogs and ancient frogs?

Respuesta :

brom2845 brom2845

20-01-2022

When did frogs evolve? Frogs developed out of lungfish about 375 million years ago, in the Devonian period. They used their lungs to leave the water and live on land

Answer Link

Otras preguntas

what did mesopotamians eat

Which of the following was a direct result of the brown v. Board of education

During your research on a topic, you run across a blog site where several people posted that fuel prices have gone up 10% in the last six months. You can provid

I will upvote Families that violate China’s “one-child” rule where it is most strictly enforced face Question 2 options: Better child care Mandatory abortion P

Billy Cobham is a talented and respected fusion drummer, and he was born in Panama. What is wrong with the sentence? a. The ideas in the independent clau

I don't understand this problem (attached)

What is the name of the process of RNA formation from DNA?

How many lines of symmetry dose this figure have?

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

From the gold foil experiment it was concluded that the atom is mostly empty space True or False